Transcript: Human NM_173800.5

Homo sapiens laeverin (LVRN), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LVRN (206338)
Length:
4604
CDS:
144..3116

Additional Resources:

NCBI RefSeq record:
NM_173800.5
NBCI Gene record:
LVRN (206338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173800.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073857 CCGGAAAGATGCAATTGCAAA pLKO.1 1136 CDS 100% 4.950 6.930 N LVRN n/a
2 TRCN0000073856 CGCATTTGTTATATGTGACTA pLKO.1 1067 CDS 100% 4.950 6.930 N LVRN n/a
3 TRCN0000073853 GCCAAATTGAACCTACTTGTA pLKO.1 4068 3UTR 100% 4.950 6.930 N LVRN n/a
4 TRCN0000073855 CCGGATGCTTTCTTGTTTCTT pLKO.1 1673 CDS 100% 5.625 3.938 N LVRN n/a
5 TRCN0000073854 GCAGCAAAGTATTCCCAGAAA pLKO.1 2035 CDS 100% 4.950 2.970 N LVRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173800.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16125 pDONR223 0% 19.8% 19.7% None (many diffs) n/a
2 ccsbBroad304_16125 pLX_304 0% 19.8% 19.7% V5 (many diffs) n/a
Download CSV