Transcript: Human NM_173858.1

Homo sapiens vomeronasal 1 receptor 5 (gene/pseudogene) (VN1R5), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
VN1R5 (317705)
Length:
1074
CDS:
1..1074

Additional Resources:

NCBI RefSeq record:
NM_173858.1
NBCI Gene record:
VN1R5 (317705)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014286 CTCAGGATGATCTTAGGTATA pLKO.1 335 CDS 100% 10.800 15.120 N VN1R5 n/a
2 TRCN0000014287 AGAGGCTACATGGTGATTATT pLKO.1 704 CDS 100% 15.000 12.000 N VN1R5 n/a
3 TRCN0000014285 CTTCACATACTGGGTGGACTT pLKO.1 834 CDS 100% 4.050 3.240 N VN1R5 n/a
4 TRCN0000358247 AGTCCATTGACATGATAATTA pLKO_005 233 CDS 100% 15.000 10.500 N VN1R5 n/a
5 TRCN0000358246 GTGGACTTTACGTTCTCATTT pLKO_005 847 CDS 100% 13.200 9.240 N VN1R5 n/a
6 TRCN0000358245 TCAGGATGATCTTAGGTATAA pLKO_005 336 CDS 100% 13.200 9.240 N VN1R5 n/a
7 TRCN0000014283 CCAGCTTTGGAATTTCAGCAA pLKO.1 158 CDS 100% 2.640 1.848 N VN1R5 n/a
8 TRCN0000014284 CATGGCAGAAATTATGCTATT pLKO.1 27 CDS 100% 10.800 6.480 N VN1R5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05422 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05422 pLX_304 0% 100% 100% V5 n/a
Download CSV