Transcript: Mouse NM_174874.3

Mus musculus autophagy related 4B, cysteine peptidase (Atg4b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Atg4b (66615)
Length:
2964
CDS:
13..1194

Additional Resources:

NCBI RefSeq record:
NM_174874.3
NBCI Gene record:
Atg4b (66615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030942 GACGAAATCTTGTCTGATGTT pLKO.1 130 CDS 100% 4.950 6.930 N Atg4b n/a
2 TRCN0000308621 GACGAAATCTTGTCTGATGTT pLKO_005 130 CDS 100% 4.950 6.930 N Atg4b n/a
3 TRCN0000030939 GCCCACTACTTTATTGGCTAT pLKO.1 799 CDS 100% 4.050 5.670 N Atg4b n/a
4 TRCN0000073799 CGGTGTGGACAGATGATCTTT pLKO.1 241 CDS 100% 5.625 4.500 N ATG4B n/a
5 TRCN0000365107 GGTGTGGACAGATGATCTTTG pLKO_005 242 CDS 100% 10.800 7.560 N ATG4B n/a
6 TRCN0000030940 CCATCCATCAGATAGCGCAAA pLKO.1 383 CDS 100% 4.050 2.835 N Atg4b n/a
7 TRCN0000315570 CCATCCATCAGATAGCGCAAA pLKO_005 383 CDS 100% 4.050 2.835 N Atg4b n/a
8 TRCN0000030941 CCTTGGCTGTTCACATAGCAA pLKO.1 500 CDS 100% 3.000 2.100 N Atg4b n/a
9 TRCN0000308622 CCTTGGCTGTTCACATAGCAA pLKO_005 500 CDS 100% 3.000 2.100 N Atg4b n/a
10 TRCN0000030943 CCCATGTTTGAGCTGGTGGAA pLKO.1 1051 CDS 100% 2.640 1.848 N Atg4b n/a
11 TRCN0000308684 CCCATGTTTGAGCTGGTGGAA pLKO_005 1051 CDS 100% 2.640 1.848 N Atg4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.