Transcript: Mouse NM_174995.3

Mus musculus microsomal glutathione S-transferase 2 (Mgst2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-24
Taxon:
Mus musculus (mouse)
Gene:
Mgst2 (211666)
Length:
614
CDS:
71..514

Additional Resources:

NCBI RefSeq record:
NM_174995.3
NBCI Gene record:
Mgst2 (211666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103306 GCTGGGTGGTACTTCAATCAA pLKO.1 278 CDS 100% 5.625 7.875 N Mgst2 n/a
2 TRCN0000288407 GCTGGGTGGTACTTCAATCAA pLKO_005 278 CDS 100% 5.625 7.875 N Mgst2 n/a
3 TRCN0000103309 GTACATATACGCCCGTCACAA pLKO.1 325 CDS 100% 4.950 6.930 N Mgst2 n/a
4 TRCN0000288332 GTACATATACGCCCGTCACAA pLKO_005 325 CDS 100% 4.950 6.930 N Mgst2 n/a
5 TRCN0000103307 GTCAGCAAAGTTATTTCGCTT pLKO.1 120 CDS 100% 2.640 3.696 N Mgst2 n/a
6 TRCN0000295671 GGTCGGACGAGCAAGACTAAA pLKO_005 145 CDS 100% 13.200 9.240 N Mgst2 n/a
7 TRCN0000295672 TTATCCTGTATTCATCGTAAT pLKO_005 247 CDS 100% 10.800 7.560 N Mgst2 n/a
8 TRCN0000103308 CGAGAGAATATTTCGTGCACA pLKO.1 208 CDS 100% 2.640 1.848 N Mgst2 n/a
9 TRCN0000103305 CCTGAACGAATACCTGGACTT pLKO.1 460 CDS 100% 4.050 2.430 N Mgst2 n/a
10 TRCN0000288341 CCTGAACGAATACCTGGACTT pLKO_005 460 CDS 100% 4.050 2.430 N Mgst2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.