Transcript: Mouse NM_175006.2

Mus musculus POU domain, class 6, transcription factor 2 (Pou6f2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pou6f2 (218030)
Length:
2403
CDS:
126..2201

Additional Resources:

NCBI RefSeq record:
NM_175006.2
NBCI Gene record:
Pou6f2 (218030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085476 GAACACAATCAAACGCTTAAA pLKO.1 2114 CDS 100% 13.200 18.480 N Pou6f2 n/a
2 TRCN0000085475 GCAATAAGAGACAAGCTCTAA pLKO.1 2092 CDS 100% 4.950 6.930 N Pou6f2 n/a
3 TRCN0000015954 CCGAGAATTTGCCAAAGCTTT pLKO.1 1577 CDS 100% 4.950 3.960 N POU6F2 n/a
4 TRCN0000431308 ACCCTCTACAGCTGGTTAATA pLKO_005 1000 CDS 100% 15.000 10.500 N Pou6f2 n/a
5 TRCN0000426343 ATGCACAAGGACAGATTATTG pLKO_005 1138 CDS 100% 13.200 9.240 N Pou6f2 n/a
6 TRCN0000416945 AGATCCTCAATGCCCACTTTG pLKO_005 1984 CDS 100% 10.800 7.560 N Pou6f2 n/a
7 TRCN0000085473 CGGAAGGAAGCATCACAGAAA pLKO.1 2219 3UTR 100% 4.950 3.465 N Pou6f2 n/a
8 TRCN0000015957 GAGTGAAATGAATGCGGAGTT pLKO.1 167 CDS 100% 4.050 2.835 N POU6F2 n/a
9 TRCN0000085474 GTATGCAGAATCTCACGGAAT pLKO.1 1900 CDS 100% 4.050 2.835 N Pou6f2 n/a
10 TRCN0000085477 GCGAATCTCACAAACATCCAA pLKO.1 531 CDS 100% 3.000 2.100 N Pou6f2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.