Transcript: Mouse NM_175094.5

Mus musculus pyruvate dehydrogenase complex, component X (Pdhx), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pdhx (27402)
Length:
2527
CDS:
65..1570

Additional Resources:

NCBI RefSeq record:
NM_175094.5
NBCI Gene record:
Pdhx (27402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175094.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423370 TGATGACAAACGGACTAATAA pLKO_005 1695 3UTR 100% 15.000 21.000 N Pdhx n/a
2 TRCN0000042024 GCGGGTACATTCACCGAAATT pLKO.1 878 CDS 100% 13.200 18.480 N Pdhx n/a
3 TRCN0000042025 CGCGGGATCTTCACTAAAGAA pLKO.1 686 CDS 100% 5.625 7.875 N Pdhx n/a
4 TRCN0000042023 GCGTATTTATTTAAGGCGAAA pLKO.1 1622 3UTR 100% 4.050 3.240 N Pdhx n/a
5 TRCN0000423287 ACCAGGTTTCTTGAAACTTTC pLKO_005 1514 CDS 100% 10.800 7.560 N Pdhx n/a
6 TRCN0000419256 GTAAACTACATCCTATGTTTG pLKO_005 1780 3UTR 100% 10.800 7.560 N Pdhx n/a
7 TRCN0000042027 CCAGCTTATAACGGTCACAAT pLKO.1 1456 CDS 100% 4.950 3.465 N Pdhx n/a
8 TRCN0000042026 GCCAAGATAGTGGTTGAGGAA pLKO.1 395 CDS 100% 2.640 1.848 N Pdhx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175094.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.