Transcript: Mouse NM_175166.3

Mus musculus RIKEN cDNA 5430419D17 gene (5430419D17Rik), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
5430419D17Rik (71395)
Length:
2928
CDS:
20..2545

Additional Resources:

NCBI RefSeq record:
NM_175166.3
NBCI Gene record:
5430419D17Rik (71395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175166.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089116 CAGCGATTATATGACAACAAA pLKO.1 1969 CDS 100% 5.625 7.875 N 5430419D17Rik n/a
2 TRCN0000089114 GCAGCGATTATATGACAACAA pLKO.1 1968 CDS 100% 4.950 6.930 N 5430419D17Rik n/a
3 TRCN0000449062 CAGACCTCACTCCAGTAATAG pLKO_005 390 CDS 100% 13.200 9.240 N 5430419D17Rik n/a
4 TRCN0000089113 GCCTTTCCTTCCTCTACTTTA pLKO.1 2554 3UTR 100% 13.200 9.240 N 5430419D17Rik n/a
5 TRCN0000089117 CCGAATTTGAACCTGGAAGAT pLKO.1 1814 CDS 100% 4.950 3.465 N 5430419D17Rik n/a
6 TRCN0000089115 CCAGCCACCATATTATCAGTT pLKO.1 227 CDS 100% 4.950 2.970 N 5430419D17Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175166.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.