Transcript: Mouse NM_175176.3

Mus musculus glutamate rich 3 (Erich3), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Erich3 (209601)
Length:
2009
CDS:
187..1740

Additional Resources:

NCBI RefSeq record:
NM_175176.3
NBCI Gene record:
Erich3 (209601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182685 GCCGCATAGCAATGCAGTTAT pLKO.1 444 CDS 100% 13.200 18.480 N Erich3 n/a
2 TRCN0000367013 ACGCTGTTAAATACGACTATG pLKO_005 1076 CDS 100% 10.800 15.120 N Erich3 n/a
3 TRCN0000367011 TCCGAGATGAAATCAAGATTT pLKO_005 518 CDS 100% 13.200 10.560 N Erich3 n/a
4 TRCN0000376263 AGGATCCTGGAAGGATTTATA pLKO_005 416 CDS 100% 15.000 10.500 N Erich3 n/a
5 TRCN0000198606 CCTTGCTACAGGTGCATTATT pLKO.1 775 CDS 100% 15.000 10.500 N Erich3 n/a
6 TRCN0000377223 AGTTATCACAATGGTCTATTT pLKO_005 459 CDS 100% 13.200 9.240 N Erich3 n/a
7 TRCN0000177589 CCGAGATGAAATCAAGATTTA pLKO.1 519 CDS 100% 13.200 9.240 N Erich3 n/a
8 TRCN0000376137 CTTGCTACAGGTGCATTATTG pLKO_005 776 CDS 100% 13.200 9.240 N Erich3 n/a
9 TRCN0000367012 GATGACAGACAAGATGTTAAA pLKO_005 1303 CDS 100% 13.200 9.240 N Erich3 n/a
10 TRCN0000367010 TGATTCTGGAAGGATTCTTTA pLKO_005 1811 3UTR 100% 13.200 9.240 N Erich3 n/a
11 TRCN0000177488 GCTGTTAAATACGACTATGAA pLKO.1 1078 CDS 100% 5.625 3.938 N Erich3 n/a
12 TRCN0000182062 CCAATCGAGAAGTACTTGGAA pLKO.1 1489 CDS 100% 3.000 2.100 N Erich3 n/a
13 TRCN0000182663 GCAGGAAAGAACTTCAGGGAT pLKO.1 319 CDS 100% 2.640 1.848 N Erich3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175176.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.