Transcript: Mouse NM_175210.3

Mus musculus ATP-binding cassette, sub-family A (ABC1), member 12 (Abca12), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Abca12 (74591)
Length:
8323
CDS:
329..8116

Additional Resources:

NCBI RefSeq record:
NM_175210.3
NBCI Gene record:
Abca12 (74591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442326 TATGGTCGCCTGGGTTGTATT pLKO_005 3538 CDS 100% 13.200 18.480 N Abca12 n/a
2 TRCN0000113457 CGCTATTTAAAGAAAGCGAAA pLKO.1 630 CDS 100% 4.050 5.670 N Abca12 n/a
3 TRCN0000113456 CCCTTTACAAAGACATCATTA pLKO.1 2667 CDS 100% 13.200 10.560 N Abca12 n/a
4 TRCN0000113455 CCGAGATAATTTCTCGTGTAT pLKO.1 2097 CDS 100% 0.495 0.396 N Abca12 n/a
5 TRCN0000419598 AGCATTGAGAGAGCAATTATT pLKO_005 3398 CDS 100% 15.000 10.500 N Abca12 n/a
6 TRCN0000113459 CCATTCCCATTCCAGACAATA pLKO.1 2073 CDS 100% 13.200 9.240 N Abca12 n/a
7 TRCN0000113458 CACGCATCCTTGGTTTGGAAA pLKO.1 813 CDS 100% 4.950 3.465 N Abca12 n/a
8 TRCN0000059444 GCCATTTCTTTGCCTGGCTTA pLKO.1 3645 CDS 100% 4.050 2.835 N ABCA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.