Transcript: Mouse NM_175238.5

Mus musculus replication timing regulatory factor 1 (Rif1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Rif1 (51869)
Length:
8502
CDS:
44..7324

Additional Resources:

NCBI RefSeq record:
NM_175238.5
NBCI Gene record:
Rif1 (51869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175238.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071339 CCCTCTATGATCCGAGAAATA pLKO.1 2597 CDS 100% 13.200 18.480 N Rif1 n/a
2 TRCN0000071340 GCACCTTATGACTACTAAATT pLKO.1 742 CDS 100% 15.000 10.500 N Rif1 n/a
3 TRCN0000071341 GCCCAGATGAGCACTGAAATT pLKO.1 6002 CDS 100% 13.200 9.240 N Rif1 n/a
4 TRCN0000155022 GCTATCTGGAAGGAGCTAATT pLKO.1 1550 CDS 100% 13.200 9.240 N RIF1 n/a
5 TRCN0000071342 CCAGCATATCAGGTTGCTAAT pLKO.1 1751 CDS 100% 10.800 7.560 N Rif1 n/a
6 TRCN0000154312 CCAGCATATCAGGTTGCTAAT pLKO.1 1751 CDS 100% 10.800 7.560 N RIF1 n/a
7 TRCN0000071338 GCTCTTCAACTGGACTCAGAA pLKO.1 7181 CDS 100% 4.950 3.465 N Rif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175238.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.