Transcript: Mouse NM_175251.4

Mus musculus AT rich interactive domain 2 (ARID, RFX-like) (Arid2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Arid2 (77044)
Length:
9029
CDS:
174..5660

Additional Resources:

NCBI RefSeq record:
NM_175251.4
NBCI Gene record:
Arid2 (77044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225733 ACCTGTCCCGCCTACTAATAA pLKO_005 3098 CDS 100% 15.000 10.500 N Arid2 n/a
2 TRCN0000218090 GACTAACAGCTGCCTTAATAT pLKO_005 5461 CDS 100% 15.000 10.500 N Arid2 n/a
3 TRCN0000225735 TTCTTACTTGAGCCAATATAT pLKO_005 6208 3UTR 100% 15.000 10.500 N Arid2 n/a
4 TRCN0000166359 CCGACTAACAGCTGCCTTAAT pLKO.1 5459 CDS 100% 13.200 9.240 N ARID2 n/a
5 TRCN0000225732 TCGCTTGTCAGTGGCTAAATG pLKO_005 1741 CDS 100% 13.200 9.240 N Arid2 n/a
6 TRCN0000225734 CCGTGCCCATTTCGAACTTAC pLKO_005 3598 CDS 100% 10.800 7.560 N Arid2 n/a
7 TRCN0000201553 CGGCAGAGGTTCTCTTTCATT pLKO.1 5184 CDS 100% 5.625 3.938 N Arid2 n/a
8 TRCN0000166321 CCTCCTTCAAACTCAGGGAAA pLKO.1 4068 CDS 100% 4.050 2.835 N ARID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175251.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.