Transcript: Mouse NM_175287.4

Mus musculus RIKEN cDNA A430005L14 gene (A430005L14Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
A430005L14Rik (97159)
Length:
1109
CDS:
72..764

Additional Resources:

NCBI RefSeq record:
NM_175287.4
NBCI Gene record:
A430005L14Rik (97159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283162 TTGCAGCCGGTGTCAAGATTC pLKO_005 778 3UTR 100% 10.800 8.640 N A430005L14Rik n/a
2 TRCN0000190601 GCCGGTGTCAAGATTCTGTAT pLKO.1 783 3UTR 100% 4.950 3.465 N A430005L14Rik n/a
3 TRCN0000190458 GCTTCCTCATCACACAAAGCT pLKO.1 201 CDS 100% 3.000 2.100 N A430005L14Rik n/a
4 TRCN0000264759 CACCAGCCTCTTCATCTTATC pLKO_005 670 CDS 100% 10.800 6.480 N A430005L14Rik n/a
5 TRCN0000264761 TGACCCTAAGAGTGACATTTC pLKO_005 293 CDS 100% 10.800 6.480 N A430005L14Rik n/a
6 TRCN0000216879 GACCCTAAGAGTGACATTTCT pLKO.1 294 CDS 100% 5.625 3.375 N A430005L14Rik n/a
7 TRCN0000264760 CACCTTGTGAAGGCAGAATTA pLKO_005 264 CDS 100% 13.200 6.600 Y A430005L14Rik n/a
8 TRCN0000201540 CTTCGGGAATGTCGAGCTTAT pLKO.1 638 CDS 100% 10.800 5.400 Y A430005L14Rik n/a
9 TRCN0000264762 CTTCGGGAATGTCGAGCTTAT pLKO_005 638 CDS 100% 10.800 5.400 Y A430005L14Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175287.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.