Transcript: Mouse NM_175294.3

Mus musculus nuclear casein kinase and cyclin-dependent kinase substrate 1 (Nucks1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nucks1 (98415)
Length:
6096
CDS:
277..981

Additional Resources:

NCBI RefSeq record:
NM_175294.3
NBCI Gene record:
Nucks1 (98415)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099345 GCCACCAGAATCAGTCTTAAT pLKO.1 1906 3UTR 100% 13.200 10.560 N Nucks1 n/a
2 TRCN0000099348 CAGCGATGAAGATTTCCTAAT pLKO.1 669 CDS 100% 10.800 7.560 N Nucks1 n/a
3 TRCN0000332194 CAGCGATGAAGATTTCCTAAT pLKO_005 669 CDS 100% 10.800 7.560 N Nucks1 n/a
4 TRCN0000099349 CTTCGAAGAAATCAAAGGAAA pLKO.1 857 CDS 100% 4.950 3.465 N Nucks1 n/a
5 TRCN0000332196 CTTCGAAGAAATCAAAGGAAA pLKO_005 857 CDS 100% 4.950 3.465 N Nucks1 n/a
6 TRCN0000197193 GCGATGAAGATTTCCTAATGG pLKO.1 671 CDS 100% 4.950 3.465 N NUCKS1 n/a
7 TRCN0000099346 GTTGTGGATTACTCTCAGTTT pLKO.1 304 CDS 100% 4.950 3.465 N Nucks1 n/a
8 TRCN0000332197 GTTGTGGATTACTCTCAGTTT pLKO_005 304 CDS 100% 4.950 3.465 N Nucks1 n/a
9 TRCN0000099347 CAGCATCTAAAGCAGCTTCTA pLKO.1 560 CDS 100% 4.950 2.970 N Nucks1 n/a
10 TRCN0000332272 CAGCATCTAAAGCAGCTTCTA pLKO_005 560 CDS 100% 4.950 2.970 N Nucks1 n/a
11 TRCN0000082472 CCAAACCCAGACTAAAGGCTA pLKO.1 785 CDS 100% 2.640 2.112 N NUCKS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.