Transcript: Mouse NM_175300.4

Mus musculus anaphase promoting complex subunit 2 (Anapc2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Anapc2 (99152)
Length:
3021
CDS:
51..2564

Additional Resources:

NCBI RefSeq record:
NM_175300.4
NBCI Gene record:
Anapc2 (99152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175300.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012799 GCGACGTTCTTCAGACATCAT pLKO.1 1580 CDS 100% 4.950 6.930 N Anapc2 n/a
2 TRCN0000285054 GCGACGTTCTTCAGACATCAT pLKO_005 1580 CDS 100% 4.950 6.930 N Anapc2 n/a
3 TRCN0000012800 GCGACAATTATTGCCTCCGAT pLKO.1 105 CDS 100% 2.640 3.696 N Anapc2 n/a
4 TRCN0000012802 CCACGTACAGAGATTCTTCTA pLKO.1 1073 CDS 100% 4.950 3.960 N Anapc2 n/a
5 TRCN0000273776 CCACGTACAGAGATTCTTCTA pLKO_005 1073 CDS 100% 4.950 3.960 N Anapc2 n/a
6 TRCN0000273777 ACGACCTTCAAGGCAATATTG pLKO_005 337 CDS 100% 13.200 9.240 N Anapc2 n/a
7 TRCN0000012801 GCATACATCCAGGCCATGTTA pLKO.1 2361 CDS 100% 5.625 3.938 N Anapc2 n/a
8 TRCN0000273725 GCATACATCCAGGCCATGTTA pLKO_005 2361 CDS 100% 5.625 3.938 N Anapc2 n/a
9 TRCN0000012798 CCCATGAATACAAACAGGTTT pLKO.1 2729 3UTR 100% 4.950 3.465 N Anapc2 n/a
10 TRCN0000273724 CTAGATGGACAGCTTCTATTT pLKO_005 2612 3UTR 100% 13.200 7.920 N Anapc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175300.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08129 pDONR223 100% 84.6% 92.4% None (many diffs) n/a
Download CSV