Transcript: Mouse NM_175374.3

Mus musculus mitochondrial translational release factor 1-like (Mtrf1l), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mtrf1l (108853)
Length:
2621
CDS:
181..1302

Additional Resources:

NCBI RefSeq record:
NM_175374.3
NBCI Gene record:
Mtrf1l (108853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429525 TTATGAGGCTCTAGTAGAAAT pLKO_005 1263 CDS 100% 13.200 18.480 N Mtrf1l n/a
2 TRCN0000192023 CCTACAGGTATTATTTCTGAA pLKO.1 958 CDS 100% 4.950 6.930 N Mtrf1l n/a
3 TRCN0000189488 CCAGCAGTACGCTGCATTTAA pLKO.1 618 CDS 100% 15.000 10.500 N Mtrf1l n/a
4 TRCN0000437150 CACGACCTTGAGAGCTTTATG pLKO_005 1189 CDS 100% 13.200 9.240 N Mtrf1l n/a
5 TRCN0000201129 CTGGTGATCAATCCTAAAGAT pLKO.1 853 CDS 100% 5.625 3.938 N Mtrf1l n/a
6 TRCN0000192901 GCATCAGATTATCTCACTGTT pLKO.1 492 CDS 100% 4.950 3.465 N Mtrf1l n/a
7 TRCN0000200693 GTGAAATAGCTTTGTGTCAAA pLKO.1 452 CDS 100% 4.950 3.465 N Mtrf1l n/a
8 TRCN0000149953 GCTGAAGCATCAGATTATCTT pLKO.1 486 CDS 100% 5.625 3.938 N MTRF1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.