Transcript: Mouse NM_175380.5

Mus musculus glycerol-3-phosphate dehydrogenase 1-like (Gpd1l), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gpd1l (333433)
Length:
4393
CDS:
271..1326

Additional Resources:

NCBI RefSeq record:
NM_175380.5
NBCI Gene record:
Gpd1l (333433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175380.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181480 CCACAAGATCTGCGATGAGAT pLKO.1 570 CDS 100% 4.950 3.465 N Gpd1l n/a
2 TRCN0000181920 CGACATCATCCGAGAGAAGAT pLKO.1 675 CDS 100% 4.950 3.465 N Gpd1l n/a
3 TRCN0000198423 GAAGCTAATCTCCGACATCAT pLKO.1 663 CDS 100% 4.950 3.465 N Gpd1l n/a
4 TRCN0000178093 GCAGTGTATCAGATCTGCTAT pLKO.1 1246 CDS 100% 4.950 3.465 N Gpd1l n/a
5 TRCN0000176849 GCTGACAGACATAATCAACAA pLKO.1 423 CDS 100% 4.950 3.465 N Gpd1l n/a
6 TRCN0000181554 GAAATTCTCCTCCACCGTCAA pLKO.1 366 CDS 100% 4.050 2.835 N Gpd1l n/a
7 TRCN0000181869 GCTTTCGCCAAGATCTTCTGT pLKO.1 985 CDS 100% 3.000 2.100 N Gpd1l n/a
8 TRCN0000198647 CGTGAAATATCTCCCAGGACA pLKO.1 456 CDS 100% 2.640 1.848 N Gpd1l n/a
9 TRCN0000182050 CTGCAGTGTATCAGATCTGCT pLKO.1 1244 CDS 100% 2.640 1.848 N Gpd1l n/a
10 TRCN0000198530 GCCCAACTTCAGAATCACTGT pLKO.1 825 CDS 100% 2.640 1.848 N Gpd1l n/a
11 TRCN0000182015 CAAGATCTTCTGTAAGGGCCA pLKO.1 993 CDS 100% 0.540 0.378 N Gpd1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175380.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.