Transcript: Mouse NM_175391.4

Mus musculus apolipoprotein L 7c (Apol7c), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Apol7c (108956)
Length:
2044
CDS:
167..1276

Additional Resources:

NCBI RefSeq record:
NM_175391.4
NBCI Gene record:
Apol7c (108956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105149 GACTTATTTCTGGATCTACAA pLKO.1 888 CDS 100% 4.950 3.465 N Apol7c n/a
2 TRCN0000105147 CCAGACTTATTTCTGGATCTA pLKO.1 885 CDS 100% 0.495 0.347 N Apol7c n/a
3 TRCN0000105145 CCTCATTGTGTGTTTATCCAA pLKO.1 1670 3UTR 100% 3.000 1.800 N Apol7c n/a
4 TRCN0000105148 GCCAACCAACAAAGACACAAT pLKO.1 829 CDS 100% 4.950 2.475 Y Apol7c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175391.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.