Transcript: Mouse NM_175414.4

Mus musculus tetraspanin 9 (Tspan9), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tspan9 (109246)
Length:
3930
CDS:
183..902

Additional Resources:

NCBI RefSeq record:
NM_175414.4
NBCI Gene record:
Tspan9 (109246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381983 CACATCCACCGGACAGGTAAA pLKO_005 867 CDS 100% 10.800 15.120 N Tspan9 n/a
2 TRCN0000380885 TGGACAAGGTGAACGAGAATG pLKO_005 505 CDS 100% 10.800 7.560 N Tspan9 n/a
3 TRCN0000094959 CACACTGACACTTGTTCCTAT pLKO.1 1204 3UTR 100% 4.950 3.465 N Tspan9 n/a
4 TRCN0000325584 CACACTGACACTTGTTCCTAT pLKO_005 1204 3UTR 100% 4.950 3.465 N Tspan9 n/a
5 TRCN0000094960 GCTGGCAGAGTTGATTCTGAT pLKO.1 464 CDS 100% 4.950 3.465 N Tspan9 n/a
6 TRCN0000325508 GCTGGCAGAGTTGATTCTGAT pLKO_005 464 CDS 100% 4.950 3.465 N Tspan9 n/a
7 TRCN0000094961 GCTGTGGTTTGATGACAACAA pLKO.1 767 CDS 100% 4.950 3.465 N Tspan9 n/a
8 TRCN0000325509 GCTGTGGTTTGATGACAACAA pLKO_005 767 CDS 100% 4.950 3.465 N Tspan9 n/a
9 TRCN0000094962 GTACACGATGTTCCTCTTCAA pLKO.1 212 CDS 100% 4.950 3.465 N Tspan9 n/a
10 TRCN0000325510 GTACACGATGTTCCTCTTCAA pLKO_005 212 CDS 100% 4.950 3.465 N Tspan9 n/a
11 TRCN0000094963 CATCATGCAGATCCTGGGAAT pLKO.1 821 CDS 100% 4.050 2.835 N Tspan9 n/a
12 TRCN0000381466 GAACATCATCCAGGCCGAGAT pLKO_005 596 CDS 100% 4.050 2.835 N Tspan9 n/a
13 TRCN0000382021 TCATCGTGCTGTTGATCATCC pLKO_005 442 CDS 100% 4.050 2.835 N Tspan9 n/a
14 TRCN0000119250 CACTGACTACACAGACTGGTA pLKO.1 632 CDS 100% 2.640 1.848 N TSPAN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175414.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.