Transcript: Mouse NM_175438.4

Mus musculus aldehyde dehydrogenase 4 family, member A1 (Aldh4a1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Aldh4a1 (212647)
Length:
3355
CDS:
246..1934

Additional Resources:

NCBI RefSeq record:
NM_175438.4
NBCI Gene record:
Aldh4a1 (212647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041426 GCACCTTTGTGGCATCAATTT pLKO.1 1073 CDS 100% 13.200 10.560 N Aldh4a1 n/a
2 TRCN0000041425 GCCCTTTAACCATGCACACAA pLKO.1 491 CDS 100% 4.950 3.960 N Aldh4a1 n/a
3 TRCN0000434894 AGGTGTGGACCTCCGATATAC pLKO_005 457 CDS 100% 13.200 9.240 N Aldh4a1 n/a
4 TRCN0000443656 CAAGGCCTTTGCTCGCATTAA pLKO_005 1424 CDS 100% 13.200 9.240 N Aldh4a1 n/a
5 TRCN0000041424 CGGTCCTGTGTTGACAGTATA pLKO.1 1589 CDS 100% 13.200 9.240 N Aldh4a1 n/a
6 TRCN0000418630 GTGTACCCAGATGATAAATAC pLKO_005 1611 CDS 100% 13.200 9.240 N Aldh4a1 n/a
7 TRCN0000416839 TACACATGTCCAGTGAGATAG pLKO_005 2329 3UTR 100% 10.800 7.560 N Aldh4a1 n/a
8 TRCN0000430677 AGAACCTAAAGGGATATTCTC pLKO_005 2231 3UTR 100% 4.950 3.465 N Aldh4a1 n/a
9 TRCN0000041427 GCAACTTCTACATCAACGATA pLKO.1 1747 CDS 100% 4.950 3.465 N Aldh4a1 n/a
10 TRCN0000438255 GTTGTCAAGCAGATGTCCATC pLKO_005 1953 3UTR 100% 4.050 2.835 N Aldh4a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07281 pDONR223 100% 86.7% 91.2% None (many diffs) n/a
2 ccsbBroad304_07281 pLX_304 0% 86.7% 91.2% V5 (many diffs) n/a
Download CSV