Transcript: Mouse NM_175549.4

Mus musculus roundabout guidance receptor 2 (Robo2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Robo2 (268902)
Length:
8047
CDS:
1..4527

Additional Resources:

NCBI RefSeq record:
NM_175549.4
NBCI Gene record:
Robo2 (268902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099785 CCGGCATTTATAGCTGGCATT pLKO.1 2575 CDS 100% 4.050 5.670 N Robo2 n/a
2 TRCN0000099786 CGCGTATATCATTGAGGCTTT pLKO.1 1659 CDS 100% 4.050 3.240 N Robo2 n/a
3 TRCN0000099788 CCCACCACTCTGAACTGTAAA pLKO.1 139 CDS 100% 13.200 9.240 N Robo2 n/a
4 TRCN0000099787 CCCAACACAATCTACTTGTTT pLKO.1 1759 CDS 100% 5.625 3.938 N Robo2 n/a
5 TRCN0000099789 GCTGACAGTTGGAAGTCACAA pLKO.1 2235 CDS 100% 4.950 3.465 N Robo2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175549.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.