Transcript: Mouse NM_175558.4

Mus musculus zinc finger protein 446 (Zfp446), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp446 (269870)
Length:
4617
CDS:
5..1576

Additional Resources:

NCBI RefSeq record:
NM_175558.4
NBCI Gene record:
Zfp446 (269870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175558.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084743 GCCTACTAACTCTGCCTGTAA pLKO.1 2579 3UTR 100% 4.950 6.930 N Zfp446 n/a
2 TRCN0000084745 TGTAGCTTTGACTGGAAGTTT pLKO.1 1511 CDS 100% 5.625 3.938 N Zfp446 n/a
3 TRCN0000084744 CACATAATAGAGTTGCTGATT pLKO.1 494 CDS 100% 4.950 3.465 N Zfp446 n/a
4 TRCN0000084747 CCAGATCAGTTGCAGTGTGAA pLKO.1 790 CDS 100% 4.950 3.465 N Zfp446 n/a
5 TRCN0000084746 CTGTAGCTTTGACTGGAAGTT pLKO.1 1510 CDS 100% 4.950 3.465 N Zfp446 n/a
6 TRCN0000178741 CACACACATACACACACACAA pLKO.1 4242 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175558.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.