Transcript: Mouse NM_175645.3

Mus musculus xylosyltransferase 1 (Xylt1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Xylt1 (233781)
Length:
3070
CDS:
201..3062

Additional Resources:

NCBI RefSeq record:
NM_175645.3
NBCI Gene record:
Xylt1 (233781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432425 GACGCTGGTGGTGTGGAATTT pLKO_005 284 CDS 100% 13.200 18.480 N Xylt1 n/a
2 TRCN0000427398 ATCTACCACAAAGACCATTTC pLKO_005 1227 CDS 100% 10.800 7.560 N Xylt1 n/a
3 TRCN0000093688 TCCAACAAGCAGCCCATCAAA pLKO.1 2715 CDS 100% 5.625 3.938 N Xylt1 n/a
4 TRCN0000093686 CCTGGAGTGTGATACACACAT pLKO.1 1586 CDS 100% 4.950 3.465 N Xylt1 n/a
5 TRCN0000093684 GCCACCTATGATATCCTGATT pLKO.1 2559 CDS 100% 4.950 3.465 N Xylt1 n/a
6 TRCN0000093687 AGAAACCTACTGTCGCCACAA pLKO.1 1025 CDS 100% 4.050 2.835 N Xylt1 n/a
7 TRCN0000034880 CGGGACAATGCAAGGTTCATT pLKO.1 1539 CDS 100% 5.625 3.938 N XYLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.