Transcript: Mouse NM_175731.4

Mus musculus alkaline ceramidase 1 (Acer1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Acer1 (171168)
Length:
2429
CDS:
19..840

Additional Resources:

NCBI RefSeq record:
NM_175731.4
NBCI Gene record:
Acer1 (171168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175731.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124851 CTGGTAACTATAACCACTATT pLKO.1 412 CDS 100% 13.200 18.480 N Acer1 n/a
2 TRCN0000124850 CCTGGTAACTATAACCACTAT pLKO.1 411 CDS 100% 4.950 6.930 N Acer1 n/a
3 TRCN0000124852 GCAGCGGATTCACTTCTACTA pLKO.1 636 CDS 100% 4.950 3.960 N Acer1 n/a
4 TRCN0000124849 CCCTCCTTATATCCATCCATT pLKO.1 1799 3UTR 100% 4.950 3.465 N Acer1 n/a
5 TRCN0000124853 CGTCCTCATAAGCATCACATT pLKO.1 675 CDS 100% 4.950 3.465 N Acer1 n/a
6 TRCN0000190964 CCTCTCAAGTGCTGGGATTAA pLKO.1 2157 3UTR 100% 13.200 6.600 Y Nop16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175731.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.