Transcript: Human NM_176811.2

Homo sapiens NLR family pyrin domain containing 8 (NLRP8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NLRP8 (126205)
Length:
3934
CDS:
72..3218

Additional Resources:

NCBI RefSeq record:
NM_176811.2
NBCI Gene record:
NLRP8 (126205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420788 TCAAGGTAACGGGCATCTAAA pLKO_005 2507 CDS 100% 13.200 18.480 N NLRP8 n/a
2 TRCN0000130225 CCCTAGAATTTGGACTGATCT pLKO.1 2474 CDS 100% 4.950 6.930 N NLRP8 n/a
3 TRCN0000129678 CAAGGTGTCTTTCGGTAATAA pLKO.1 1802 CDS 100% 15.000 10.500 N NLRP8 n/a
4 TRCN0000131011 CCACAGAACCTCAGCTTTGAA pLKO.1 3346 3UTR 100% 5.625 3.938 N NLRP8 n/a
5 TRCN0000128642 CATGAGTATTCTTCGGAGAAT pLKO.1 1538 CDS 100% 0.495 0.347 N NLRP8 n/a
6 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 3605 3UTR 100% 5.625 2.813 Y NLRP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.