Transcript: Human NM_176819.4

Homo sapiens divergent protein kinase domain 2B (DIPK2B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DIPK2B (79742)
Length:
4631
CDS:
51..1352

Additional Resources:

NCBI RefSeq record:
NM_176819.4
NBCI Gene record:
DIPK2B (79742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_176819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433812 TTTAGACTGGTCAGCAAATAT pLKO_005 390 CDS 100% 15.000 21.000 N DIPK2B n/a
2 TRCN0000172233 CTCCCGATTCCTTGCTTTCTT pLKO.1 319 CDS 100% 5.625 7.875 N DIPK2B n/a
3 TRCN0000417131 AGTCAGAACCAGCTACAATTT pLKO_005 179 CDS 100% 13.200 9.240 N DIPK2B n/a
4 TRCN0000166885 CTGCAAATTACTCAGATGATT pLKO.1 343 CDS 100% 5.625 3.938 N DIPK2B n/a
5 TRCN0000168214 CCTCGGTCTTGATAAATGCAA pLKO.1 212 CDS 100% 3.000 2.100 N DIPK2B n/a
6 TRCN0000173070 CCTGAGCTGTTCTTTCTCCTT pLKO.1 125 CDS 100% 2.640 1.848 N DIPK2B n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2842 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2843 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 3160 3UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.