Transcript: Mouse NM_177047.3

Mus musculus autism susceptibility candidate 2 (Auts2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Auts2 (319974)
Length:
6060
CDS:
521..4306

Additional Resources:

NCBI RefSeq record:
NM_177047.3
NBCI Gene record:
Auts2 (319974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251086 CGAGACTCCTCCGTTAGTAAA pLKO_005 3014 CDS 100% 13.200 18.480 N Auts2 n/a
2 TRCN0000251085 TACGCCTCTGTCGGCTGAAAT pLKO_005 4237 CDS 100% 13.200 18.480 N Auts2 n/a
3 TRCN0000251083 TCGTGAGCTGACGGTTCATAT pLKO_005 4715 3UTR 100% 13.200 18.480 N Auts2 n/a
4 TRCN0000251087 CAGCCGAAGAGGACATCATTG pLKO_005 765 CDS 100% 10.800 8.640 N Auts2 n/a
5 TRCN0000251084 CATATCGCCTGGCAGATTTAT pLKO_005 2480 CDS 100% 15.000 10.500 N Auts2 n/a
6 TRCN0000119057 CCCTTCAACTATGCAATGAAT pLKO.1 4893 3UTR 100% 5.625 7.875 N AUTS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.