Transcript: Mouse NM_177152.5

Mus musculus leucine-rich repeats and immunoglobulin-like domains 3 (Lrig3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lrig3 (320398)
Length:
4050
CDS:
258..3611

Additional Resources:

NCBI RefSeq record:
NM_177152.5
NBCI Gene record:
Lrig3 (320398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177152.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108505 CCGGGAATAACTTTCATATAA pLKO.1 3784 3UTR 100% 15.000 10.500 N Lrig3 n/a
2 TRCN0000108509 CCAGATCCATTTGAAGTTTAT pLKO.1 3069 CDS 100% 13.200 9.240 N Lrig3 n/a
3 TRCN0000108508 GCTGAACAGAAACAAGATTAA pLKO.1 920 CDS 100% 13.200 9.240 N Lrig3 n/a
4 TRCN0000108506 CCACCCTTACAACTCAAGTAT pLKO.1 750 CDS 100% 5.625 3.938 N Lrig3 n/a
5 TRCN0000108507 CGGCTACTTCAAGTAACTCAT pLKO.1 3340 CDS 100% 4.950 3.465 N Lrig3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177152.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.