Transcript: Mouse NM_177155.4

Mus musculus killer cell lectin-like receptor family I member 2 (Klri2), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Klri2 (320407)
Length:
3913
CDS:
67..813

Additional Resources:

NCBI RefSeq record:
NM_177155.4
NBCI Gene record:
Klri2 (320407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126536 CTTCTTGATTCCAAGCTTATT pLKO.1 357 CDS 100% 13.200 9.240 N Klri2 n/a
2 TRCN0000126537 GAACAAACAAGCAGGAGATTA pLKO.1 95 CDS 100% 13.200 9.240 N Klri2 n/a
3 TRCN0000126534 CCTGGTTTAATGTGTTTGTAT pLKO.1 3160 3UTR 100% 5.625 3.938 N Klri2 n/a
4 TRCN0000126538 CGGAACACCCTAATGAATGAT pLKO.1 691 CDS 100% 5.625 3.938 N Klri2 n/a
5 TRCN0000126535 GCTTCTTGATTCCAAGCTTAT pLKO.1 356 CDS 100% 10.800 6.480 N Klri2 n/a
6 TRCN0000452375 AGAATCATAGCTGCCATTATC pLKO_005 722 CDS 100% 13.200 6.600 Y Klri2 n/a
7 TRCN0000193975 GAAGAATCATAGCTGCCATTA pLKO.1 720 CDS 100% 10.800 5.400 Y Klri1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177155.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.