Transcript: Mouse NM_177184.3

Mus musculus vacuolar protein sorting 13C (Vps13c), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vps13c (320528)
Length:
11523
CDS:
32..11278

Additional Resources:

NCBI RefSeq record:
NM_177184.3
NBCI Gene record:
Vps13c (320528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246774 CTCGGAAAGTTCTCGATTTAA pLKO_005 2079 CDS 100% 15.000 21.000 N Vps13c n/a
2 TRCN0000246772 TTCCGTGTTTCTGTCGATATT pLKO_005 3734 CDS 100% 13.200 18.480 N Vps13c n/a
3 TRCN0000150987 CGGACAAAGTTAATCCAACAA pLKO.1 9902 CDS 100% 4.950 6.930 N VPS13C n/a
4 TRCN0000246773 TGGGATGTCCTCACGTATAAA pLKO_005 8969 CDS 100% 15.000 12.000 N Vps13c n/a
5 TRCN0000246775 CCCTATCCGGTGCCCTATTAA pLKO_005 9535 CDS 100% 15.000 10.500 N Vps13c n/a
6 TRCN0000246776 GGCCTGCTCAAGAGAACATTT pLKO_005 11323 3UTR 100% 13.200 9.240 N Vps13c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.