Transcript: Mouse NM_177298.3

Mus musculus phosphatidylserine decarboxylase (Pisd), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Pisd (320951)
Length:
2150
CDS:
14..1234

Additional Resources:

NCBI RefSeq record:
NM_177298.3
NBCI Gene record:
Pisd (320951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115414 CCCTGTCACTATGAATCTACT pLKO.1 80 CDS 100% 4.950 6.930 N Pisd n/a
2 TRCN0000115415 CAGGTGTCAGAAATTTCCATA pLKO.1 147 CDS 100% 4.950 3.465 N Pisd n/a
3 TRCN0000417136 CTTACAGAAATTGCCTCTTCA pLKO_005 124 CDS 100% 4.950 3.465 N Pisd n/a
4 TRCN0000115413 CAGTATGAGAAGTACAGGGAA pLKO.1 248 CDS 100% 2.640 1.848 N Pisd n/a
5 TRCN0000436785 CCGTATCCACTTTGACCGAGA pLKO_005 991 CDS 100% 2.160 1.512 N Pisd n/a
6 TRCN0000115411 CCAGTGTCTTCTGAGGACAAT pLKO.1 1723 3UTR 100% 4.950 2.970 N Pisd n/a
7 TRCN0000115412 TCCTACAATGACCTGAGCTTT pLKO.1 1046 CDS 100% 4.950 2.970 N Pisd n/a
8 TRCN0000115421 CGATGGATCAAAGAGCTCTTT pLKO.1 881 CDS 100% 4.950 2.475 Y Pisd-ps1 n/a
9 TRCN0000115425 CGCCTCAACCAAGTAGAACTT pLKO.1 377 CDS 100% 4.950 2.475 Y Pisd-ps1 n/a
10 TRCN0000078465 CAAGGGCTCCTACAATGACTT pLKO.1 1039 CDS 100% 4.950 3.465 N PISD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.