Transcript: Mouse NM_177358.4

Mus musculus zinc finger protein 945 (Zfp945), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Zfp945 (240041)
Length:
6618
CDS:
392..2713

Additional Resources:

NCBI RefSeq record:
NM_177358.4
NBCI Gene record:
Zfp945 (240041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217709 GCCATTACCGTGCTGATATAA pLKO.1 1323 CDS 100% 15.000 12.000 N Zfp945 n/a
2 TRCN0000242006 GCCATTACCGTGCTGATATAA pLKO_005 1323 CDS 100% 15.000 12.000 N Zfp945 n/a
3 TRCN0000243575 CCAGGGAACCATGCAAGTATA pLKO_005 759 CDS 100% 13.200 9.240 N Zfp945 n/a
4 TRCN0000243572 TATTGACTTGTGGCAATTAAC pLKO_005 6023 3UTR 100% 13.200 9.240 N Zfp945 n/a
5 TRCN0000243573 TTGGAGGATATCCCTACAAAT pLKO_005 1089 CDS 100% 13.200 9.240 N Zfp945 n/a
6 TRCN0000216214 CATCACTTGTCACAATCAAAC pLKO.1 811 CDS 100% 10.800 7.560 N Zfp945 n/a
7 TRCN0000243574 CATCACTTGTCACAATCAAAC pLKO_005 811 CDS 100% 10.800 7.560 N Zfp945 n/a
8 TRCN0000201334 GCACTATGTATGCTGTGAGAA pLKO.1 3689 3UTR 100% 4.950 3.465 N Zfp945 n/a
9 TRCN0000215349 CATGCTACAAAGAATACTTAC pLKO.1 1169 CDS 100% 10.800 6.480 N Zfp945 n/a
10 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1760 CDS 100% 15.000 7.500 Y Gm13212 n/a
11 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1759 CDS 100% 15.000 7.500 Y Zfp984 n/a
12 TRCN0000191011 CAGGAGACAAACCTTACAAAT pLKO.1 2433 CDS 100% 13.200 6.600 Y Zfp945 n/a
13 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1845 CDS 100% 13.200 6.600 Y Znf41-ps n/a
14 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1845 CDS 100% 13.200 6.600 Y EG666605 n/a
15 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 1603 CDS 100% 10.800 5.400 Y Rex2 n/a
16 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 1604 CDS 100% 13.200 6.600 Y Gm13212 n/a
17 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 2522 CDS 100% 4.950 2.475 Y ZNF28 n/a
18 TRCN0000235274 ATACTGGAGAGAGACCTTATG pLKO_005 1422 CDS 100% 10.800 5.400 Y Gm10771 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.