Transcript: Mouse NM_177360.3

Mus musculus doublesex and mab-3 related transcription factor 3 (Dmrt3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dmrt3 (240590)
Length:
2401
CDS:
263..1693

Additional Resources:

NCBI RefSeq record:
NM_177360.3
NBCI Gene record:
Dmrt3 (240590)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086168 CCACTAATACTGTATACTCTT pLKO.1 1773 3UTR 100% 4.950 6.930 N Dmrt3 n/a
2 TRCN0000086172 GCGGCCATATCTTTGAACACA pLKO.1 1203 CDS 100% 3.000 4.200 N Dmrt3 n/a
3 TRCN0000422263 GTCAGCTTTACTCCCTAAATT pLKO_005 1996 3UTR 100% 15.000 10.500 N Dmrt3 n/a
4 TRCN0000426847 GACTGTGCTTGATAGTCTATA pLKO_005 1813 3UTR 100% 13.200 9.240 N Dmrt3 n/a
5 TRCN0000086171 CCTCGGATTCTAGAATACTCA pLKO.1 1659 CDS 100% 3.000 2.100 N Dmrt3 n/a
6 TRCN0000086169 CAGTCCATCTACACAGAGGAT pLKO.1 1616 CDS 100% 2.640 1.848 N Dmrt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.