Transcript: Mouse NM_177367.3

Mus musculus gem nuclear organelle associated protein 4 (Gemin4), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Gemin4 (276919)
Length:
3448
CDS:
86..3262

Additional Resources:

NCBI RefSeq record:
NM_177367.3
NBCI Gene record:
Gemin4 (276919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427748 AGACCTCAACACGACGTTTAA pLKO_005 1657 CDS 100% 13.200 18.480 N Gemin4 n/a
2 TRCN0000009656 CGCAAATTAGACCAGCTAGAT pLKO.1 2366 CDS 100% 4.950 6.930 N Gemin4 n/a
3 TRCN0000009657 CCATCCTCCAAAGAGGTTTAA pLKO.1 676 CDS 100% 13.200 9.240 N Gemin4 n/a
4 TRCN0000430590 CATCAGCTCTGATCGGGTTAT pLKO_005 1477 CDS 100% 10.800 7.560 N Gemin4 n/a
5 TRCN0000009658 GCCTCAGATCAAGCAGGTAAT pLKO.1 1504 CDS 100% 10.800 7.560 N Gemin4 n/a
6 TRCN0000423457 CCATTGCCATGGCCATCATTG pLKO_005 1299 CDS 100% 10.800 6.480 N Gemin4 n/a
7 TRCN0000009654 CCCAGAGCTAAGAACAAACAA pLKO.1 3318 3UTR 100% 5.625 3.375 N Gemin4 n/a
8 TRCN0000009655 GCTGACATGCTGAGTGTGTTT pLKO.1 815 CDS 100% 4.950 2.970 N Gemin4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.