Transcript: Mouse NM_177411.4

Mus musculus RAB5B, member RAS oncogene family (Rab5b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rab5b (19344)
Length:
3180
CDS:
182..829

Additional Resources:

NCBI RefSeq record:
NM_177411.4
NBCI Gene record:
Rab5b (19344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100624 CGTGGTCTATGATATTACTAA pLKO.1 472 CDS 100% 5.625 7.875 N Rab5b n/a
2 TRCN0000305926 TCGGGCAAAGACATGGGTAAA pLKO_005 508 CDS 100% 10.800 8.640 N Rab5b n/a
3 TRCN0000311442 AGCCAGCCCTAGCATTGTTAT pLKO_005 544 CDS 100% 13.200 9.240 N Rab5b n/a
4 TRCN0000381840 GGAAGTCTAGCCTGGTGTTAC pLKO_005 276 CDS 100% 10.800 7.560 N Rab5b n/a
5 TRCN0000382494 TATGAAGAGGCTCAGGCATAT pLKO_005 614 CDS 100% 10.800 7.560 N Rab5b n/a
6 TRCN0000100622 CCTGGCAATAGCAAAGAAGTT pLKO.1 703 CDS 100% 4.950 3.465 N Rab5b n/a
7 TRCN0000100620 GCACTTTAATTGATGGTAGTT pLKO.1 1766 3UTR 100% 4.950 3.465 N Rab5b n/a
8 TRCN0000325390 GCACTTTAATTGATGGTAGTT pLKO_005 1766 3UTR 100% 4.950 3.465 N Rab5b n/a
9 TRCN0000100621 CCGTGTGTTTAGATGACACAA pLKO.1 363 CDS 100% 0.495 0.347 N Rab5b n/a
10 TRCN0000305990 CAAAGGACAGTTCCATGAATA pLKO_005 304 CDS 100% 13.200 7.920 N Rab5b n/a
11 TRCN0000305924 AGACTGCTATGAACGTGAATG pLKO_005 675 CDS 100% 10.800 6.480 N Rab5b n/a
12 TRCN0000100623 GCAGATGACAACAGCTTATTA pLKO.1 635 CDS 100% 15.000 7.500 Y Rab5b n/a
13 TRCN0000296415 GCAGATGACAACAGCTTATTG pLKO_005 635 CDS 100% 13.200 6.600 Y RAB5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.