Transcript: Mouse NM_177562.5

Mus musculus C-type lectin domain family 16, member A (Clec16a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Clec16a (74374)
Length:
6262
CDS:
225..3335

Additional Resources:

NCBI RefSeq record:
NM_177562.5
NBCI Gene record:
Clec16a (74374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177562.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195795 CCACGAGACATCGCTCTATTA pLKO.1 551 CDS 100% 13.200 18.480 N Clec16a n/a
2 TRCN0000341541 CCACGAGACATCGCTCTATTA pLKO_005 551 CDS 100% 13.200 18.480 N Clec16a n/a
3 TRCN0000352573 CCGAAAGCATGGTTCGAATTG pLKO_005 769 CDS 100% 10.800 15.120 N Clec16a n/a
4 TRCN0000184789 CGGATCATATCCGCTGCATTA pLKO.1 2563 CDS 100% 10.800 8.640 N Clec16a n/a
5 TRCN0000184817 CCCAGTGCATAAACCAGCATA pLKO.1 2833 CDS 100% 4.950 3.960 N Clec16a n/a
6 TRCN0000195826 CGAGGAGATCATGGCGTATTA pLKO.1 629 CDS 100% 13.200 9.240 N Clec16a n/a
7 TRCN0000341542 CGAGGAGATCATGGCGTATTA pLKO_005 629 CDS 100% 13.200 9.240 N Clec16a n/a
8 TRCN0000341543 CTTCGTGTTCTCGGATCATAT pLKO_005 2552 CDS 100% 13.200 9.240 N Clec16a n/a
9 TRCN0000341544 TGGAGAAGCAAACCTAGATAA pLKO_005 3706 3UTR 100% 13.200 9.240 N Clec16a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177562.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.