Transcript: Mouse NM_177585.3

Mus musculus IQ motif containing J (Iqcj), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Iqcj (208426)
Length:
1579
CDS:
94..426

Additional Resources:

NCBI RefSeq record:
NM_177585.3
NBCI Gene record:
Iqcj (208426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191116 GCTTGGCATTATTGCCTAATA pLKO.1 1316 3UTR 100% 13.200 18.480 N Iqcj n/a
2 TRCN0000284166 TTTCGCCATTGCGATCATTTA pLKO_005 1132 3UTR 100% 13.200 10.560 N Iqcj n/a
3 TRCN0000284167 CTTGGCATTATTGCCTAATAT pLKO_005 1317 3UTR 100% 15.000 10.500 N Iqcj n/a
4 TRCN0000270031 GTAACCATGCAAAGTATATTA pLKO_005 1193 3UTR 100% 15.000 10.500 N Iqcj n/a
5 TRCN0000270030 TAAGTGATGACAACCATTAAG pLKO_005 930 3UTR 100% 13.200 9.240 N Iqcj n/a
6 TRCN0000270029 TGGAAAGTCATCTTCGTTATT pLKO_005 712 3UTR 100% 13.200 9.240 N Iqcj n/a
7 TRCN0000255722 CTACAGCCCTTGGAATCAAAG pLKO_005 220 CDS 100% 10.800 5.400 Y IQCJ n/a
8 TRCN0000191067 CAGAATCCTTTAGAACAAGTT pLKO.1 121 CDS 100% 4.950 2.475 Y Iqcj n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177585.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.