Transcript: Mouse NM_177596.3

Mus musculus zinc finger protein 947 (Zfp947), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Zfp947 (210853)
Length:
2659
CDS:
327..1640

Additional Resources:

NCBI RefSeq record:
NM_177596.3
NBCI Gene record:
Zfp947 (210853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096082 CATGCAAATATCCAAGTGAAA pLKO.1 552 CDS 100% 4.950 2.970 N Zfp947 n/a
2 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1530 CDS 100% 15.000 7.500 Y Gm13212 n/a
3 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 1529 CDS 100% 15.000 7.500 Y Zfp984 n/a
4 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 943 CDS 100% 13.200 6.600 Y Zfp992 n/a
5 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 1111 CDS 100% 13.200 6.600 Y Znf41-ps n/a
6 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 1111 CDS 100% 13.200 6.600 Y EG666605 n/a
7 TRCN0000431848 GATGTGATGTTGGAGAATTAC pLKO_005 444 CDS 100% 13.200 6.600 Y Rex2 n/a
8 TRCN0000424774 GATGTTGGAGAATTACAATAA pLKO_005 449 CDS 100% 13.200 6.600 Y Znf41-ps n/a
9 TRCN0000240039 TGATGTTGGAGAATTACAATA pLKO_005 448 CDS 100% 13.200 6.600 Y Zfp991 n/a
10 TRCN0000429043 ACCTTACAAATGTAATGAATG pLKO_005 1289 CDS 100% 10.800 5.400 Y Rex2 n/a
11 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 869 CDS 100% 10.800 5.400 Y Rex2 n/a
12 TRCN0000218033 TGTATCATACAGGCAAGAAAC pLKO_005 1186 CDS 100% 10.800 5.400 Y Zfp995 n/a
13 TRCN0000096081 CCAGAAATGCTGGTTTAGAAA pLKO.1 1073 CDS 100% 5.625 2.813 Y Zfp947 n/a
14 TRCN0000096080 CCATGAGTTCACCGGAAGTAT pLKO.1 605 CDS 100% 5.625 2.813 Y Zfp947 n/a
15 TRCN0000096083 CCCAGAAATGCTGGTTTAGAA pLKO.1 1072 CDS 100% 5.625 2.813 Y Zfp947 n/a
16 TRCN0000096079 GCAGCAATGAAGGAAATCTTT pLKO.1 2211 3UTR 100% 5.625 2.813 Y Zfp947 n/a
17 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 870 CDS 100% 13.200 6.600 Y Gm13212 n/a
18 TRCN0000284909 TGTAATGAATGTGACAAATTC pLKO_005 1299 CDS 100% 13.200 6.600 Y Zfp980 n/a
19 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 940 CDS 100% 10.800 5.400 Y Gm14308 n/a
20 TRCN0000085361 GCAGTCTTAGTATTCATCAAA pLKO.1 997 CDS 100% 5.625 2.813 Y Zfp944 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.