Transcript: Mouse NM_177657.5

Mus musculus RIKEN cDNA D630003M21 gene (D630003M21Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
D630003M21Rik (228846)
Length:
3941
CDS:
139..3702

Additional Resources:

NCBI RefSeq record:
NM_177657.5
NBCI Gene record:
D630003M21Rik (228846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177657.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110141 CCACCGTTTCAGAAGGAAGAT pLKO.1 2991 CDS 100% 4.950 3.465 N D630003M21Rik n/a
2 TRCN0000110144 GTAGTGACATTAAGTGTAGAT pLKO.1 1018 CDS 100% 4.950 3.465 N D630003M21Rik n/a
3 TRCN0000110143 GTGGTGATTGATGCCAGGAAA pLKO.1 2020 CDS 100% 4.950 3.465 N D630003M21Rik n/a
4 TRCN0000110140 TGACAGGATTGACAGAGGGAT pLKO.1 3739 3UTR 100% 2.640 1.848 N D630003M21Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177657.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.