Transcript: Mouse NM_177670.4

Mus musculus transmembrane protein 69 (Tmem69), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem69 (230657)
Length:
2409
CDS:
166..903

Additional Resources:

NCBI RefSeq record:
NM_177670.4
NBCI Gene record:
Tmem69 (230657)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177670.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250818 GGCCCAAGAGACCCGATTAAA pLKO_005 884 CDS 100% 15.000 21.000 N Tmem69 n/a
2 TRCN0000217103 CTAGCAGTATGAGTCCTATTC pLKO.1 653 CDS 100% 10.800 15.120 N Tmem69 n/a
3 TRCN0000250819 CTAGCAGTATGAGTCCTATTC pLKO_005 653 CDS 100% 10.800 15.120 N Tmem69 n/a
4 TRCN0000250821 TATCTAGGCTGGGAGCTAAAC pLKO_005 1224 3UTR 100% 10.800 15.120 N Tmem69 n/a
5 TRCN0000258114 ATGTGTCACCATGCAACTTTA pLKO_005 362 CDS 100% 13.200 10.560 N Tmem69 n/a
6 TRCN0000250820 ATCTCATTTGTAGTCACTTTA pLKO_005 835 CDS 100% 13.200 9.240 N Tmem69 n/a
7 TRCN0000192744 GCTTTCACTCAGATGGCTTAT pLKO.1 541 CDS 100% 10.800 6.480 N Tmem69 n/a
8 TRCN0000191401 CCCAATTAAATGTTGTCCTTT pLKO.1 2284 3UTR 100% 4.950 2.475 Y D130079A08Rik n/a
9 TRCN0000191196 CCTTGATGATAATGAACTGAA pLKO.1 2242 3UTR 100% 4.950 2.475 Y Tmem69 n/a
10 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 1682 3UTR 100% 2.640 1.320 Y P3h3 n/a
11 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 1682 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177670.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.