Transcript: Mouse NM_177671.5

Mus musculus Eph receptor A10 (Epha10), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Epha10 (230735)
Length:
1236
CDS:
91..969

Additional Resources:

NCBI RefSeq record:
NM_177671.5
NBCI Gene record:
Epha10 (230735)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177671.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023509 AGAGACCTTCAACGCATACTA pLKO.1 459 CDS 100% 5.625 4.500 N Epha10 n/a
2 TRCN0000362111 TCGGTGCGTGTCTACTACAAG pLKO_005 697 CDS 100% 4.950 3.960 N Epha10 n/a
3 TRCN0000362186 AGGGATGGGATAGGGACATAT pLKO_005 957 CDS 100% 13.200 9.240 N Epha10 n/a
4 TRCN0000362185 CAACGCATACTACCTAGAAAC pLKO_005 468 CDS 100% 10.800 7.560 N Epha10 n/a
5 TRCN0000023511 TCAACGCATACTACCTAGAAA pLKO.1 467 CDS 100% 5.625 3.938 N Epha10 n/a
6 TRCN0000023510 GAACATGGTGACATCTGTGAA pLKO.1 919 CDS 100% 4.950 3.465 N Epha10 n/a
7 TRCN0000023512 GAGATTAGTGGCGTGGATGAA pLKO.1 268 CDS 100% 4.950 3.465 N Epha10 n/a
8 TRCN0000362112 GTGAAGAGGCAGGAGTAGAAG pLKO_005 1009 3UTR 100% 4.950 3.465 N Epha10 n/a
9 TRCN0000023513 GCAGTAGCATACCAGGTGCCA pLKO.1 425 CDS 100% 0.220 0.154 N Epha10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177671.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16148 pDONR223 0% 87.8% 92.8% None (many diffs) n/a
2 ccsbBroad304_16148 pLX_304 0% 87.8% 92.8% V5 (many diffs) n/a
Download CSV