Transcript: Mouse NM_177703.3

Mus musculus F-box and WD-40 domain protein 19 (Fbxw19), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Fbxw19 (235612)
Length:
1462
CDS:
8..1408

Additional Resources:

NCBI RefSeq record:
NM_177703.3
NBCI Gene record:
Fbxw19 (235612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099020 CCTATATCACACGGATGACTA pLKO.1 453 CDS 100% 4.950 6.930 N Fbxw19 n/a
2 TRCN0000099023 CCTCCTATATCACACGGATGA pLKO.1 450 CDS 100% 4.050 3.240 N Fbxw19 n/a
3 TRCN0000099021 CCTGTTGTCTTCCTGTCAATT pLKO.1 568 CDS 100% 13.200 9.240 N Fbxw19 n/a
4 TRCN0000099024 GCCCACTGCTTAGGAGGTGTT pLKO.1 1245 CDS 100% 1.350 0.945 N Fbxw19 n/a
5 TRCN0000099022 CCACTGCTTAGGAGGTGTTAT pLKO.1 1247 CDS 100% 13.200 7.920 N Fbxw19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.