Transcript: Mouse NM_177767.4

Mus musculus 2-oxoglutarate and iron-dependent oxygenase domain containing 1 (Ogfod1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ogfod1 (270086)
Length:
5329
CDS:
92..1729

Additional Resources:

NCBI RefSeq record:
NM_177767.4
NBCI Gene record:
Ogfod1 (270086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177767.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039214 GCGAAATACGAGTTCACTGAT pLKO.1 521 CDS 100% 4.950 6.930 N Ogfod1 n/a
2 TRCN0000039218 CTCAGCTTTAAGGAAACTTAT pLKO.1 427 CDS 100% 13.200 9.240 N Ogfod1 n/a
3 TRCN0000038905 GCAGATTGTCAAGTCTCTTAT pLKO.1 673 CDS 100% 13.200 9.240 N OGFOD1 n/a
4 TRCN0000039217 GCTGAGGTTTGTGAAACACAT pLKO.1 1627 CDS 100% 4.950 3.465 N Ogfod1 n/a
5 TRCN0000039216 CCAAACTTCATCCAAAGCCAA pLKO.1 290 CDS 100% 2.640 1.848 N Ogfod1 n/a
6 TRCN0000039215 GCAAAGAAAGAATCGAGCGTT pLKO.1 1376 CDS 100% 2.640 1.848 N Ogfod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177767.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.