Transcript: Mouse NM_177778.4

Mus musculus armadillo repeat containing 7 (Armc7), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Armc7 (276905)
Length:
2249
CDS:
261..857

Additional Resources:

NCBI RefSeq record:
NM_177778.4
NBCI Gene record:
Armc7 (276905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177778.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195827 CAGTACCTACGGCAACTACAA pLKO.1 411 CDS 100% 4.950 3.960 N Armc7 n/a
2 TRCN0000184052 CGGCCCAACCTCTAATCTAAT pLKO.1 1826 3UTR 100% 13.200 9.240 N Armc7 n/a
3 TRCN0000320064 CGGCCCAACCTCTAATCTAAT pLKO_005 1826 3UTR 100% 13.200 9.240 N Armc7 n/a
4 TRCN0000180656 CAACTACAAGTCCTGGACTTA pLKO.1 423 CDS 100% 4.950 3.465 N Armc7 n/a
5 TRCN0000319985 CAACTACAAGTCCTGGACTTA pLKO_005 423 CDS 100% 4.950 3.465 N Armc7 n/a
6 TRCN0000184645 CCACAGGTATAGGAAGCAGAA pLKO.1 881 3UTR 100% 4.050 2.835 N Armc7 n/a
7 TRCN0000195780 CCTTGATTCTCTGTCGGAAGA pLKO.1 446 CDS 100% 4.050 2.835 N Armc7 n/a
8 TRCN0000183498 GAAACCCTAATCAAGTTTGCT pLKO.1 471 CDS 100% 3.000 2.100 N Armc7 n/a
9 TRCN0000319986 GAAACCCTAATCAAGTTTGCT pLKO_005 471 CDS 100% 3.000 2.100 N Armc7 n/a
10 TRCN0000184017 CCCAGATATTCCTAGAGGACT pLKO.1 739 CDS 100% 2.640 1.848 N Armc7 n/a
11 TRCN0000319987 CCCAGATATTCCTAGAGGACT pLKO_005 739 CDS 100% 2.640 1.848 N Armc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177778.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.