Transcript: Mouse NM_177787.4

Mus musculus solute carrier family 15, member 5 (Slc15a5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc15a5 (277898)
Length:
2461
CDS:
1..1701

Additional Resources:

NCBI RefSeq record:
NM_177787.4
NBCI Gene record:
Slc15a5 (277898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102043 CGAGATGGATCGAGTTGGTTA pLKO.1 811 CDS 100% 4.950 6.930 N Slc15a5 n/a
2 TRCN0000102042 GAGGCGCTTATCCTGTGTTTA pLKO.1 389 CDS 100% 13.200 9.240 N Slc15a5 n/a
3 TRCN0000102040 GCCCTCAAACTTAACTATGTA pLKO.1 2303 3UTR 100% 5.625 3.938 N Slc15a5 n/a
4 TRCN0000102041 GCAACTGTCTACTTCCCTCTA pLKO.1 1088 CDS 100% 4.050 2.835 N Slc15a5 n/a
5 TRCN0000102044 CGGAAGGCAATTGGTTTCCAA pLKO.1 1439 CDS 100% 3.000 2.100 N Slc15a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.