Transcript: Mouse NM_177798.3

Mus musculus fibroblast growth factor receptor substrate 2 (Frs2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Frs2 (327826)
Length:
5701
CDS:
356..1882

Additional Resources:

NCBI RefSeq record:
NM_177798.3
NBCI Gene record:
Frs2 (327826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097281 CCGACAGTCTTTAACTTTGAT pLKO.1 1604 CDS 100% 5.625 7.875 N Frs2 n/a
2 TRCN0000097282 CGACAGTCTTTAACTTTGATA pLKO.1 1605 CDS 100% 5.625 4.500 N Frs2 n/a
3 TRCN0000097280 CCTGTCAACAAACTGGTGTAT pLKO.1 1253 CDS 100% 4.950 3.960 N Frs2 n/a
4 TRCN0000061719 CCCGTGCAGAAGAATTATTTA pLKO.1 630 CDS 100% 15.000 10.500 N FRS2 n/a
5 TRCN0000370440 CTCTAAATGGCTACCATAATA pLKO_005 1488 CDS 100% 15.000 10.500 N FRS2 n/a
6 TRCN0000097279 CCTGGTTATGATCTGGATATA pLKO.1 3299 3UTR 100% 13.200 9.240 N Frs2 n/a
7 TRCN0000097283 CATCTCTAAATGGCTACCATA pLKO.1 1485 CDS 100% 4.950 3.465 N Frs2 n/a
8 TRCN0000061718 CGGAACAAGTTTAAGGTCATT pLKO.1 407 CDS 100% 4.950 3.465 N FRS2 n/a
9 TRCN0000301022 CGGAACAAGTTTAAGGTCATT pLKO_005 407 CDS 100% 4.950 3.465 N FRS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07687 pDONR223 100% 89% 95.1% None (many diffs) n/a
2 ccsbBroad304_07687 pLX_304 40.6% 89% 95.1% V5 (many diffs) n/a
Download CSV