Transcript: Mouse NM_177801.3

Mus musculus spermatogenesis associated 32 (Spata32), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Spata32 (328019)
Length:
1112
CDS:
79..1083

Additional Resources:

NCBI RefSeq record:
NM_177801.3
NBCI Gene record:
Spata32 (328019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215898 CTTGCTCTTACCTGGATATTA pLKO.1 881 CDS 100% 15.000 21.000 N Spata32 n/a
2 TRCN0000182037 CAGAATGTACCCAACCACCAT pLKO.1 563 CDS 100% 2.640 2.112 N Spata32 n/a
3 TRCN0000263422 TTGCTCTTACCTGGATATTAA pLKO_005 882 CDS 100% 15.000 10.500 N Spata32 n/a
4 TRCN0000263425 CATCTGAGAAGTCCCAGAATA pLKO_005 719 CDS 100% 13.200 9.240 N Spata32 n/a
5 TRCN0000263423 GAGCCAGAATTACCCTCTAAA pLKO_005 292 CDS 100% 13.200 9.240 N Spata32 n/a
6 TRCN0000263424 TCCCTGTGCAGACCTCTAAAC pLKO_005 428 CDS 100% 10.800 7.560 N Spata32 n/a
7 TRCN0000178490 GAAGTCCCAGAATACCTCTTT pLKO.1 726 CDS 100% 4.950 3.465 N Spata32 n/a
8 TRCN0000282625 ACATGGCCTTGCCTAACTTAG pLKO_005 680 CDS 100% 10.800 6.480 N Spata32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.