Transcript: Mouse NM_177889.5

Mus musculus zinc finger protein 82 (Zfp82), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zfp82 (330502)
Length:
2120
CDS:
396..1988

Additional Resources:

NCBI RefSeq record:
NM_177889.5
NBCI Gene record:
Zfp82 (330502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177889.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271731 CTTATGAGAAGCGCGCATTAA pLKO_005 841 CDS 100% 13.200 18.480 N Zfp82 n/a
2 TRCN0000271745 CACGTCAGAGGATCCACTTTG pLKO_005 865 CDS 100% 10.800 15.120 N Zfp82 n/a
3 TRCN0000281816 GACAGACTGTACGAGTGTAAA pLKO_005 1308 CDS 100% 13.200 9.240 N Zfp82 n/a
4 TRCN0000271730 TAGGAAGGCCTTTCGACTTAA pLKO_005 1838 CDS 100% 13.200 9.240 N Zfp82 n/a
5 TRCN0000271751 TCGCTACTCACAGCTTATTTC pLKO_005 1601 CDS 100% 13.200 9.240 N Zfp82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177889.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09963 pDONR223 100% 82.6% 85.1% None (many diffs) n/a
2 ccsbBroad304_09963 pLX_304 0% 82.6% 85.1% V5 (many diffs) n/a
3 TRCN0000472935 GCTTTTTGACGATCAATCTAGCAC pLX_317 7.3% 82.6% 85.1% V5 (many diffs) n/a
Download CSV