Transcript: Mouse NM_177901.3

Mus musculus RIKEN cDNA 4933402J07 gene (4933402J07Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
4933402J07Rik (330820)
Length:
1023
CDS:
110..922

Additional Resources:

NCBI RefSeq record:
NM_177901.3
NBCI Gene record:
4933402J07Rik (330820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181782 GCTCCCGACAACAACTATGAA pLKO.1 665 CDS 100% 5.625 7.875 N 4933402J07Rik n/a
2 TRCN0000198782 CCGAAGACAAAGCTCTGTAGA pLKO.1 577 CDS 100% 4.950 6.930 N 4933402J07Rik n/a
3 TRCN0000181310 CCGACAACAACTATGAACGCA pLKO.1 669 CDS 100% 0.750 1.050 N 4933402J07Rik n/a
4 TRCN0000198058 CCAACTTCAGGGATAGCAATA pLKO.1 456 CDS 100% 10.800 7.560 N 4933402J07Rik n/a
5 TRCN0000177666 CGAAGACAAAGCTCTGTAGAT pLKO.1 578 CDS 100% 4.950 3.465 N 4933402J07Rik n/a
6 TRCN0000198436 GAGCACAGACATAGACATCAA pLKO.1 514 CDS 100% 4.950 3.465 N 4933402J07Rik n/a
7 TRCN0000198855 CATCCTGAGAGAATGGGCAAA pLKO.1 640 CDS 100% 4.050 2.835 N 4933402J07Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.