Transcript: Mouse NM_177911.4

Mus musculus transglutaminase 4 (prostate) (Tgm4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tgm4 (331046)
Length:
2767
CDS:
70..2082

Additional Resources:

NCBI RefSeq record:
NM_177911.4
NBCI Gene record:
Tgm4 (331046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177911.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104667 CGAGTATAAAGCTGGAGTATT pLKO.1 420 CDS 100% 13.200 18.480 N Tgm4 n/a
2 TRCN0000437844 AGTCTGGCGTAGAGGTTATTC pLKO_005 344 CDS 100% 13.200 9.240 N Tgm4 n/a
3 TRCN0000104665 CCATGTACAGAGCCCAGATAT pLKO.1 2383 3UTR 100% 13.200 9.240 N Tgm4 n/a
4 TRCN0000413664 TTCAGGTCAGGGATGGTTAAA pLKO_005 2174 3UTR 100% 13.200 9.240 N Tgm4 n/a
5 TRCN0000104666 CCACTGATACAACCCTGTGTT pLKO.1 1757 CDS 100% 4.950 3.465 N Tgm4 n/a
6 TRCN0000104669 CGCCAAACAAATTAAAGAGAA pLKO.1 549 CDS 100% 4.950 3.465 N Tgm4 n/a
7 TRCN0000104668 GCTAACATGAAATCCTGGGAA pLKO.1 1915 CDS 100% 2.640 1.848 N Tgm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177911.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.