Transcript: Human NM_177985.3

Homo sapiens ADP ribosylation factor like GTPase 5A (ARL5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
ARL5A (26225)
Length:
5006
CDS:
99..527

Additional Resources:

NCBI RefSeq record:
NM_177985.3
NBCI Gene record:
ARL5A (26225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344229 TGGAACACTTACTATACTAAC pLKO_005 216 CDS 100% 10.800 15.120 N ARL5A n/a
2 TRCN0000381571 GGCCAAGAATCTCTTCGTTCT pLKO_005 192 CDS 100% 4.050 5.670 N ARL5A n/a
3 TRCN0000153296 GCCAAGAATCTCTTCGTTCTT pLKO.1 193 CDS 100% 0.495 0.693 N ARL5A n/a
4 TRCN0000152961 GAATGGATGATGTCACGACTT pLKO.1 495 CDS 100% 4.050 3.240 N ARL5A n/a
5 TRCN0000344227 ATGGATGATGTCACGACTTAA pLKO_005 497 CDS 100% 13.200 9.240 N ARL5A n/a
6 TRCN0000344226 GTTTCCTAATGTGGGATATTG pLKO_005 169 CDS 100% 13.200 9.240 N ARL5A n/a
7 TRCN0000382272 TGAAGCTAACTTCTATTAAAG pLKO_005 412 CDS 100% 13.200 9.240 N ARL5A n/a
8 TRCN0000344306 TTGAAGCTGTGATTGACATTT pLKO_005 736 3UTR 100% 13.200 9.240 N ARL5A n/a
9 TRCN0000152288 CCTGGAACACTTACTATACTA pLKO.1 214 CDS 100% 5.625 3.938 N ARL5A n/a
10 TRCN0000151015 GAGAGAGGATTTCTGTAACTA pLKO.1 274 CDS 100% 5.625 3.938 N ARL5A n/a
11 TRCN0000153250 GCATGACTGTAGCAGAAATCT pLKO.1 382 CDS 100% 5.625 3.938 N ARL5A n/a
12 TRCN0000154289 GACAGAGAGAGGATTTCTGTA pLKO.1 270 CDS 100% 0.495 0.347 N ARL5A n/a
13 TRCN0000344304 GACAGAGAGAGGATTTCTGTA pLKO_005 270 CDS 100% 0.495 0.347 N ARL5A n/a
14 TRCN0000380126 AGAGTTTGTAATAGTTGTTGT pLKO_005 239 CDS 100% 4.950 2.970 N ARL5A n/a
15 TRCN0000011946 CCAAGGACTTGAATGGATGAT pLKO.1 485 CDS 100% 4.950 2.970 N Arl5a n/a
16 TRCN0000345074 CCAAGGACTTGAATGGATGAT pLKO_005 485 CDS 100% 4.950 2.970 N Arl5a n/a
17 TRCN0000153996 CCTTCCAGTTTGCTTTCTCAT pLKO.1 693 3UTR 100% 4.950 2.970 N ARL5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177985.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.